GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.
Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation.
Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations.
Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia.
Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.